Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 1631113
End position: 1631139
Length: 27

DNA sequence
>NC_014319, from 1631113 to 1631139 (27 bp); Leuconostoc gasicomitatum LMG 18811 TTTTGCAACCTTTGCAACCTTTGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1630538-1631290	Sequence	LEGAS_1592 - prophage terminase small subunit (Protein is coded in complementary strand; from 1631290 to 1630538)