Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 757381
End position: 757404
Length: 24

DNA sequence
>NC_014319, from 757381 to 757404 (24 bp); Leuconostoc gasicomitatum LMG 18811 TAAAAAAATAACAAAATCAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 756732-757409	Sequence	LEGAS_0738 dedA putative selenite transport protein DedA