Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 1311073
End position: 1311096
Length: 24

DNA sequence
>NC_014319, from 1311073 to 1311096 (24 bp); Leuconostoc gasicomitatum LMG 18811 GTTGTTGATGTTGTGGTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1310721-1311182	Sequence	LEGAS_1268 sepF FtsZ-interacting protein (Protein is coded in complementary strand; from 1311182 to 1310721)