Sequence retrieval

Genome: Leuconostoc gasicomitatum LMG 18811
Start position: 1228234
End position: 1228257
Length: 24

DNA sequence
>NC_014319, from 1228234 to 1228257 (24 bp); Leuconostoc gasicomitatum LMG 18811 TTGTATTTGTGTTTGTGTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1225917-1228310	Sequence	LEGAS_1191 ftsK cell division protein (Protein is coded in complementary strand; from 1228310 to 1225917)