Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 991409
End position: 991444
Length: 36

DNA sequence
>NC_014313, from 991409 to 991444 (36 bp); Hyphomicrobium denitrificans ATCC 51888 GCCTGTGCGCCAGACTGTGCGCCAGACGGTGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 991286-992677	Sequence	Hden_0938 - RND family efflux transporter MFP subunit (Protein is coded in complementary strand; from 992677 to 991286)