Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 62845
End position: 62868
Length: 24

DNA sequence
>NC_014313, from 62845 to 62868 (24 bp); Hyphomicrobium denitrificans ATCC 51888 GACGGCGACGTCGATGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 61850-65215	Sequence	Hden_0048 - Sigma 54 interacting domain-containing protein (Protein is coded in complementary strand; from 65215 to 61850)