Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 3538208
End position: 3538231
Length: 24

DNA sequence
>NC_014313, from 3538208 to 3538231 (24 bp); Hyphomicrobium denitrificans ATCC 51888 CGCCGCCGCCGAAGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3538189-3539031	Sequence	Hden_3463 - hypothetical protein (Protein is coded in complementary strand; from 3539031 to 3538189)