Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 3308288
End position: 3308323
Length: 36

DNA sequence
>NC_014313, from 3308288 to 3308323 (36 bp); Hyphomicrobium denitrificans ATCC 51888 ATTCAGTGCCTGGTTCAGTGTCTGGTTCAGTGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3308315-3309475	Sequence	Hden_3232 - AFG1-family ATPase (Protein is coded in complementary strand; from 3309475 to 3308315)