Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 3071492
End position: 3071527
Length: 36

DNA sequence
>NC_014313, from 3071492 to 3071527 (36 bp); Hyphomicrobium denitrificans ATCC 51888 TTCGTCGTCTTCGTCTTCGTCTTCATCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3071259-3071735	Sequence	Hden_2976 - hypothetical protein (Protein is coded in complementary strand; from 3071735 to 3071259)