Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 2815825
End position: 2815848
Length: 24

DNA sequence
>NC_014313, from 2815825 to 2815848 (24 bp); Hyphomicrobium denitrificans ATCC 51888 CCGTCGCCGCCGCCGTGGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2815385-2816596	Sequence	Hden_2737 - binding-protein-dependent transporters inner membrane component