Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 2597201
End position: 2597227
Length: 27

DNA sequence
>NC_014313, from 2597201 to 2597227 (27 bp); Hyphomicrobium denitrificans ATCC 51888 CCATTCCGCCCATGCCGCCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2597194-2598840	Sequence	Hden_2546 - chaperonin GroEL (Protein is coded in complementary strand; from 2598840 to 2597194)