Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 2342610
End position: 2342633
Length: 24

DNA sequence
>NC_014313, from 2342610 to 2342633 (24 bp); Hyphomicrobium denitrificans ATCC 51888 ATGATCGTGATCATGACCGTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2342539-2343213	Sequence	Hden_2294 - hypothetical protein (Protein is coded in complementary strand; from 2343213 to 2342539)