Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 2309857
End position: 2309892
Length: 36

DNA sequence
>NC_014313, from 2309857 to 2309892 (36 bp); Hyphomicrobium denitrificans ATCC 51888 GGGTTCCGGTTCGAGTTCGGGCTCGGGTTCGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2308379-2310379	Sequence	Hden_2255 - hypothetical protein (Protein is coded in complementary strand; from 2310379 to 2308379)