Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 2263744
End position: 2263806
Length: 63

DNA sequence
>NC_014313, from 2263744 to 2263806 (63 bp); Hyphomicrobium denitrificans ATCC 51888 GCCGCCGTGACCCCAACCGCCTCCGCCATGTCCCCAGCCGCCACCACCGTGGCCCCAACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263580-2263981	Sequence	Hden_2209 - hypothetical protein (Protein is coded in complementary strand; from 2263981 to 2263580)