Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 1712929
End position: 1712958
Length: 30

DNA sequence
>NC_014313, from 1712929 to 1712958 (30 bp); Hyphomicrobium denitrificans ATCC 51888 GCGGGGCGATGCGGGCCGACGCGCGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1712773-1713960	Sequence	Hden_1682 - 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (Protein is coded in complementary strand; from 1713960 to 1712773)