Sequence retrieval

Genome: Hyphomicrobium denitrificans ATCC 51888
Start position: 1712760
End position: 1712783
Length: 24

DNA sequence
>NC_014313, from 1712760 to 1712783 (24 bp); Hyphomicrobium denitrificans ATCC 51888 TCGCTCATTCGTTCATTCGCTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1712151-1712768	Sequence	Hden_1681 - cation efflux protein (Protein is coded in complementary strand; from 1712768 to 1712151)
ORF... 1712773-1713960	Sequence	Hden_1682 - 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (Protein is coded in complementary strand; from 1713960 to 1712773)