Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 769783
End position: 769806
Length: 24

DNA sequence
>NC_014230, from 769783 to 769806 (24 bp); Croceibacter atlanticus HTCC2559 TTGCTGTTGTTGTTGCAGTTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 769574-770083	Sequence	CA2559_03345 - hypothetical protein (Protein is coded in complementary strand; from 770083 to 769574)