Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 330397
End position: 330441
Length: 45

DNA sequence
>NC_014230, from 330397 to 330441 (45 bp); Croceibacter atlanticus HTCC2559 TCTTCTTTTTTCGGCTCAACTTTTTTAGGCGCTTCTTTTTTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 328132-330963	Sequence	CA2559_01335 - translation initiation factor (Protein is coded in complementary strand; from 330963 to 328132)