Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 291656
End position: 291682
Length: 27

DNA sequence
>NC_014230, from 291656 to 291682 (27 bp); Croceibacter atlanticus HTCC2559 TGGTGGCGGCGGTGGCGGCGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 291165-291884	Sequence	CA2559_01195 - TonB (Protein is coded in complementary strand; from 291884 to 291165)