Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 2877887
End position: 2877916
Length: 30

DNA sequence
>NC_014230, from 2877887 to 2877916 (30 bp); Croceibacter atlanticus HTCC2559 TAAAGTCTTTTAAATGCTTTTACAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2876693-2879179	Sequence	CA2559_13268 - hypothetical protein (Protein is coded in complementary strand; from 2879179 to 2876693)