Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 2821024
End position: 2821053
Length: 30

DNA sequence
>NC_014230, from 2821024 to 2821053 (30 bp); Croceibacter atlanticus HTCC2559 ATTTAAAAATATTTTCAAATATTGAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2819784-2821577	Sequence	CA2559_13023 - asparagine synthase (Protein is coded in complementary strand; from 2821577 to 2819784)