Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 2652680
End position: 2652704
Length: 25

DNA sequence
>NC_014230, from 2652680 to 2652704 (25 bp); Croceibacter atlanticus HTCC2559 TTTTCTTTTATTGTCTTTTAGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2652688-2653380	Sequence	CA2559_12228 - hypothetical protein (Protein is coded in complementary strand; from 2653380 to 2652688)