Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 2170202
End position: 2170225
Length: 24

DNA sequence
>NC_014230, from 2170202 to 2170225 (24 bp); Croceibacter atlanticus HTCC2559 TAACCTTTTTACCTTTTAAGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2168965-2170446	Sequence	CA2559_09918 - D-glutamate deacylase (Protein is coded in complementary strand; from 2170446 to 2168965)