Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 1716397
End position: 1716426
Length: 30

DNA sequence
>NC_014230, from 1716397 to 1716426 (30 bp); Croceibacter atlanticus HTCC2559 GGTGGTGCTGGTGGCGGTGGCGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1715659-1717533	Sequence	CA2559_07781 - hypothetical protein (Protein is coded in complementary strand; from 1717533 to 1715659)