Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 1449167
End position: 1449191
Length: 25

DNA sequence
>NC_014230, from 1449167 to 1449191 (25 bp); Croceibacter atlanticus HTCC2559 TTTTTTTATTCTTTTTCTTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1449190-1450527	Sequence	CA2559_06505 - Cell division protein FtsA (Protein is coded in complementary strand; from 1450527 to 1449190)