Sequence retrieval

Genome: Croceibacter atlanticus HTCC2559
Start position: 1199519
End position: 1199560
Length: 42

DNA sequence
>NC_014230, from 1199519 to 1199560 (42 bp); Croceibacter atlanticus HTCC2559 TTTGGAAATAGGCATTTGGGAATAGGGATTTGGGAATAGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1199124-1199534	Sequence	CA2559_05295 - hypothetical protein (Protein is coded in complementary strand; from 1199534 to 1199124)