Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 98713
End position: 98739
Length: 27

DNA sequence
>NC_014222, from 98713 to 98739 (27 bp); Methanococcus voltae A3 TTATCTATTTTATCTATTTTATCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 98287-98739	Sequence	Mvol_0096 - hypothetical protein (Protein is coded in complementary strand; from 98739 to 98287)