Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 962845
End position: 962871
Length: 27

DNA sequence
>NC_014222, from 962845 to 962871 (27 bp); Methanococcus voltae A3 TTTTTATTAGTTTTATTAGTTTTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 962506-962883	Sequence	Mvol_0849 - hypothetical protein (Protein is coded in complementary strand; from 962883 to 962506)