Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 908449
End position: 908484
Length: 36

DNA sequence
>NC_014222, from 908449 to 908484 (36 bp); Methanococcus voltae A3 TAAATATGAATCTAAATAAGTATCTAAATATTTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 907565-908542	Sequence	Mvol_0806 - permease (Protein is coded in complementary strand; from 908542 to 907565)