Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 898724
End position: 898750
Length: 27

DNA sequence
>NC_014222, from 898724 to 898750 (27 bp); Methanococcus voltae A3 CGTTATTTTCTTTATTTTCTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 898693-899448	Sequence	Mvol_0799 - hypothetical protein (Protein is coded in complementary strand; from 899448 to 898693)