Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 889821
End position: 889856
Length: 36

DNA sequence
>NC_014222, from 889821 to 889856 (36 bp); Methanococcus voltae A3 GTATCTTTATTATCTTTATTATCTTTAGTATCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 889545-890663	Sequence	Mvol_0789 - pseudouridine synthase (Protein is coded in complementary strand; from 890663 to 889545)