Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 889326
End position: 889349
Length: 24

DNA sequence
>NC_014222, from 889326 to 889349 (24 bp); Methanococcus voltae A3 TATTAGTATTAGTATTAGTATTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 888131-889561	Sequence	Mvol_0788 - dihydroorotase, multifunctional complex type (Protein is coded in complementary strand; from 889561 to 888131)