Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 882350
End position: 882394
Length: 45

DNA sequence
>NC_014222, from 882350 to 882394 (45 bp); Methanococcus voltae A3 GGTTATTATTATTATTATTATTATTATTACTATTATTACTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 882395-883570	Sequence	Mvol_0783 - beta-lactamase domain-containing protein (Protein is coded in complementary strand; from 883570 to 882395)