Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 863790
End position: 863822
Length: 33

DNA sequence
>NC_014222, from 863790 to 863822 (33 bp); Methanococcus voltae A3 ATTTATTTTTTATTTATTTTTTATTTATTAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 863811-864143	Sequence	Mvol_0768 - putative ArsR family transcriptional regulator (Protein is coded in complementary strand; from 864143 to 863811)