Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 794085
End position: 794111
Length: 27

DNA sequence
>NC_014222, from 794085 to 794111 (27 bp); Methanococcus voltae A3 TGATTTTAAGGATTTTAAAGATTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 793441-794118	Sequence	Mvol_0716 - hypothetical protein (Protein is coded in complementary strand; from 794118 to 793441)