Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 750747
End position: 750770
Length: 24

DNA sequence
>NC_014222, from 750747 to 750770 (24 bp); Methanococcus voltae A3 ATAATATTAATAACAATAATAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 749735-750859	Sequence	Mvol_0683 - transport system permease (Protein is coded in complementary strand; from 750859 to 749735)