Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 724003
End position: 724053
Length: 51

DNA sequence
>NC_014222, from 724003 to 724053 (51 bp); Methanococcus voltae A3 AGTATCAAATCTCTTAAATTTTTAAATCTCTTAAATTTTTAAATCTCTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 723050-724003	Sequence	Mvol_0665 - metallophosphoesterase (Protein is coded in complementary strand; from 724003 to 723050)