Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 710302
End position: 710337
Length: 36

DNA sequence
>NC_014222, from 710302 to 710337 (36 bp); Methanococcus voltae A3 TATTATTTTTACTATTTTTACTATTTTTATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 709476-710744	Sequence	Mvol_0652 - geranylgeranyl reductase (Protein is coded in complementary strand; from 710744 to 709476)