Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 697090
End position: 697125
Length: 36

DNA sequence
>NC_014222, from 697090 to 697125 (36 bp); Methanococcus voltae A3 TTATTAACTTTTTTATTAACTTTTTTATTAATGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 697125-697298	Sequence	Mvol_0645 - hypothetical protein (Protein is coded in complementary strand; from 697298 to 697125)