Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 695674
End position: 695709
Length: 36

DNA sequence
>NC_014222, from 695674 to 695709 (36 bp); Methanococcus voltae A3 GTAAAAAATAAAGATAAAAATAAAGATAAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 694579-695685	Sequence	Mvol_0642 - 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase, CofG subunit