Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 694673
End position: 694699
Length: 27

DNA sequence
>NC_014222, from 694673 to 694699 (27 bp); Methanococcus voltae A3 TAATAATGGTAATAAGGGTAATAAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 694579-695685	Sequence	Mvol_0642 - 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase, CofG subunit