Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 655490
End position: 655529
Length: 40

DNA sequence
>NC_014222, from 655490 to 655529 (40 bp); Methanococcus voltae A3 TTATACTTTTTTATAACTTTTTATAACTTTTTATAACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 655521-656825	Sequence	Mvol_0613 - sodium:dicarboxylate symporter (Protein is coded in complementary strand; from 656825 to 655521)