Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 642059
End position: 642088
Length: 30

DNA sequence
>NC_014222, from 642059 to 642088 (30 bp); Methanococcus voltae A3 AGAATAAATTAGAATAAATTAGAATAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 641605-642066	Sequence	Mvol_0600 - aspartate carbamoyltransferase, regulatory subunit