Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 632332
End position: 632367
Length: 36

DNA sequence
>NC_014222, from 632332 to 632367 (36 bp); Methanococcus voltae A3 AAATTTTTAAATTTTTTAAACTTTTTAAAATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 631504-632511	Sequence	Mvol_0592 - phosphate ABC transporter inner membrane subunit PstA (Protein is coded in complementary strand; from 632511 to 631504)