Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 567307
End position: 567333
Length: 27

DNA sequence
>NC_014222, from 567307 to 567333 (27 bp); Methanococcus voltae A3 ATTATATTCATTATATTCATTATATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 565514-568771	Sequence	Mvol_0543 - UvrD/REP helicase (Protein is coded in complementary strand; from 568771 to 565514)