Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 554942
End position: 554968
Length: 27

DNA sequence
>NC_014222, from 554942 to 554968 (27 bp); Methanococcus voltae A3 TTTAAATTCTTTATATTCTTTAAACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 554004-555251	Sequence	Mvol_0533 - hypothetical protein (Protein is coded in complementary strand; from 555251 to 554004)