Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 551207
End position: 551236
Length: 30

DNA sequence
>NC_014222, from 551207 to 551236 (30 bp); Methanococcus voltae A3 TTATTTTTATTATTACTTTTATTATTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 551236-551643	Sequence	Mvol_0529 - hypothetical protein (Protein is coded in complementary strand; from 551643 to 551236)