Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 54969
End position: 54998
Length: 30

DNA sequence
>NC_014222, from 54969 to 54998 (30 bp); Methanococcus voltae A3 AAAAAATTAAAAAATACTAATAAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 53759-54979	Sequence	Mvol_0053 - alpha-amylase
ORF. 54964-55092	Sequence	Mvol_0054 - hypothetical protein