Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 50327
End position: 50374
Length: 48

DNA sequence
>NC_014222, from 50327 to 50374 (48 bp); Methanococcus voltae A3 TTTTTAAATTTTCATTTAAATTTTCATTTAAATTTTTATTCAAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 49018-50535	Sequence	Mvol_0050 - ADP-specific phosphofructokinase (Protein is coded in complementary strand; from 50535 to 49018)