Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 407448
End position: 407487
Length: 40

DNA sequence
>NC_014222, from 407448 to 407487 (40 bp); Methanococcus voltae A3 AATTAATTAGAATTAATTAGAATTAATTAGAATTAATTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 407485-409068	Sequence	Mvol_0375 - Na+/H+ antiporter NhaC-like protein (Protein is coded in complementary strand; from 409068 to 407485)